A method to teach or reinforce concepts of restriction enzymes, RFLPs, and gel electrophoresis. By: Heidi Hisrich of The Dork Side

Transcription

1 A method to teach or reinforce concepts of restriction enzymes, RFLPs, and gel electrophoresis. By: Heidi Hisrich of The Dork Side

2 My students STRUGGLE with the concepts of restriction enzymes, PCR and gel electrophoresis. I made this activity to help them better understand. It can help you whether you: a) Don t have the supplies to run an ACTUAL gel and just need to do a dry lab to understand. b) Run ACTUAL gels and need to understand conceptually what is happening. BEFORE doing this activity, you need to do the following to give students the background skills to understand it. a) Teach the kids about restriction enzymes and how they work b) Teach the kids about PCR and how it works. I love this site for that: c) Teach the kids the basics of gel electrophoresis. I love this to teach it: BEFORE doing this activity, you should prepare by doing the following a) Create student teams (groups of 3-6 could work well) a. Make enough copies of the handout to provide one to EACH student b. Cut a large sheet of butcher paper for each team (represents the gel ) b) Get tape, scissors & a marker out for each team ON THE DAY OF the activity, plan to circle around the room constantly, helping students navigate the directions. Here is what you should expect students to do (you can give them these steps): a) Cut out each strip so that they have 6 genes total. They will have 3 identical dominant genes and 3 identical recessive genes. b) Separate their 6 genes to make the 3 possible genotypes (each person should make a DD, Dd and dd) c) Find the restriction sites for HaeIII (recognizes GGCC) and mark them d) Cut each gene at the restriction site (only the dominant gene gets cut and then only once) e) Create 4 lanes on their gel they need a separate lane for each of these: standards, DD, Dd, dd f) Plot the standards in the standard lane. The standard RFLPs have lengths of 20bp, 50 bp and 74 bp respectively and can be drawn with a marker. g) Measure the length of each RFLP (how many base pairs on the strip) h) Plot the RFLPs on the gel (using the standards to figure out how far they should go) & tape them down

3 Dominant Gene (D) ATTGAATTCAAGCTTAGACCATGGCCATCCATTAGGATCCGCCTGCAGTTACGGGTTTTCCGACCGGATCCTAGCGAATTCAAGCTTAATGCCCATATGG TAACTTAAGTTCGAATCTGGTACCGGTAGGTAATCCTAGGCGGACGTCAATGCCCAAAAGGCTGGCCTAGGATCGCTTAAGTTCGAATTACGGGTATACC ATTGAATTCAAGCTTAGACCATGGCCATCCATTAGGATCCGCCTGCAGTTACGGGTTTTCCGACCGGATCCTAGCGAATTCAAGCTTAATGCCCATATGG TAACTTAAGTTCGAATCTGGTACCGGTAGGTAATCCTAGGCGGACGTCAATGCCCAAAAGGCTGGCCTAGGATCGCTTAAGTTCGAATTACGGGTATACC ATTGAATTCAAGCTTAGACCATGGCCATCCATTAGGATCCGCCTGCAGTTACGGGTTTTCCGACCGGATCCTAGCGAATTCAAGCTTAATGCCCATATGG TAACTTAAGTTCGAATCTGGTACCGGTAGGTAATCCTAGGCGGACGTCAATGCCCAAAAGGCTGGCCTAGGATCGCTTAAGTTCGAATTACGGGTATACC Recessive Gene (d) ATTGAATTCAAGCTTAGGGGATGGGGATCCATTAGGATCCGCCTGCAGTTACGGGTTTTCCGACCGGATCCTAGCGAATTCAAGCTTAATGCCCATATGG TAACTTAAGTTCGAATCCCCTACCCCTAGGTAATCCTAGGCGGACGTCAATGCCCAAAAGGCTGGCCTAGGATCGCTTAAGTTCGAATTACGGGTATACC ATTGAATTCAAGCTTAGGGGATGGGGATCCATTAGGATCCGCCTGCAGTTACGGGTTTTCCGACCGGATCCTAGCGAATTCAAGCTTAATGCCCATATGG TAACTTAAGTTCGAATCCCCTACCCCTAGGTAATCCTAGGCGGACGTCAATGCCCAAAAGGCTGGCCTAGGATCGCTTAAGTTCGAATTACGGGTATACC ATTGAATTCAAGCTTAGGGGATGGGGATCCATTAGGATCCGCCTGCAGTTACGGGTTTTCCGACCGGATCCTAGCGAATTCAAGCTTAATGCCCATATGG TAACTTAAGTTCGAATCCCCTACCCCTAGGTAATCCTAGGCGGACGTCAATGCCCAAAAGGCTGGCCTAGGATCGCTTAAGTTCGAATTACGGGTATACC

4 Directions for Gel Electrophoresis Lab 1. INDIVIDUALLY, cut out the strips so that you have 6 genes total. You should have 3 identical dominant genes and 3 identical recessive genes. Keep them separate. Label the backs of each as dominant or recessive. 2. INDIVIDUALLY, separate your 6 genes to make the 3 possible genotypes (make a DD, Dd and dd) 3. INDIVIDUALLY, find the restriction sites for HaeIII (it recognizes GGCC) and mark them with a highlighter or marker 4. INDIVIDUALLY, cut each gene at the restriction site (use scissors and actually CUT IT, making sure that both pieces are still labeled on the backs. 5. AS A TEAM, create 4 lanes on your gel you need a separate lane for each of these: standards, DD, Dd, dd. The gel set-up should look like that shown below. Standard DD Dd dd 6. AS A TEAM, plot the standards in the standard lane. The standard RFLPs have lengths of 20bp, 50 bp and 74 bp respectively and can be drawn with a marker. You should show the relative distances that they will travel. 7. INDIVIDUALLY, measure the length of each RFLP that you have (how many base pairs on the strip) and mark it on the strip. 8. INDIVIDUALLY, plot the RFLPs on the gel (using the standards to figure out how far they should go) & tape them down. YES, your RFLPs will overlap each other. That s ok. Tape them on top of each other.

5 Analysis Questions 1. When you cut the genes with the scissors, what did the scissors represent? 2. Before running a gel, we run PCR. How did we simulate the PCR process in this lab? (Hint, there s a reason you were in TEAMS) 3. Your teacher tells you that a heterozygous person will always have the most RFLPs when running a gel. Explain why, using what you learned from this activity. 4. A fellow student wants to take all the DNA pieces that are the same size and lay them one below the other on the gel (like lines of text in a book), rather than stacking them. He says you ll be able to see them better. Is that a good idea? Why or why not? 5. During a lab, you forgot to add restriction enzymes to a sample containing DNA with the genotype Dd. How many RFLPs would you see on the gel and why? What genotype would they THINK they had based on the gel? And why?

6 Finished Product This is an example of what the students will make. You ll notice, the strips were a bit long for each lane. You could solve by using a wider piece of paper, but we just didn t worry about it.

7 Analysis Questions KEY 1. When you cut the genes with the scissors, what did the scissors represent? They represented restriction enzymes. In this case they represented HaeIII. 2. Before running a gel, we run PCR. How did we simulate the PCR process in this lab? (Hint, there s a reason you were in TEAMS) We simulated it by having several team members, all with the same samples of DNA. When we run PCR, that makes COPIES of the DNA, so you have lots of copies when you run a gel. 3. Your teacher tells you that a heterozygous person will always have the most RFLPs when running a gel. Explain why, using what you learned from this activity. A heterozygous person has a copy of the dominant allele and a copy of the recessive allele, so she ll have RFLPs for each. You add the number of RFLPs for the dominant gene with the number for the recessive gene and that will be the number for the heterozygous person. 4. A fellow student wants to take all the DNA pieces that are the same size and lay them one below the other on the gel (like lines of text in a book), rather than stacking them. He says you ll be able to see them better. Is that a good idea? Why or why not? It s not a good idea. The strips are the same length and have the same weight. Therefore they ll travel the same distance on the gel and will end up on top of each other. Laying them one below the other makes it look like they traveled different distances. 5. During a lab, you forgot to add restriction enzymes to a sample containing DNA with the genotype Dd. How many RFLPs would you see on the gel and why? What genotype would they THINK they had based on the gel? And why? You would see ONE RFLP because the DNA wouldn t have gotten cut, so it would be one big piece. It would look like dd because that gene didn t get cut, so it was still 100 base pairs long.